What are you working on? v16

[Richy13]

[QUOTE=Loli;28894644]Hmm... What to program... Damn my lack of both ideas and inspiration![/QUOTE]

A game for the compo?

[20k]

Rewriting my image library

[cpp]
Engine <Image> Tonic(800, 600); //screenwidth, screenheight

Tonic.add_load_end("Yai.bmp");
Tonic.add_load_end("Yai.bmp", 400, 300, 0); //x, y, transparency

Tonic.draw_all();
Tonic.flip();
[/cpp]

Hooray for lists!

[Darwin226]

[QUOTE=Loli;28894644]Hmm... What to program... Damn my lack of both ideas and inspiration![/QUOTE]

An interpreted scripting language.

[backwardspy]

[QUOTE=esalaka;28894019]I made sort-of-an encoder.
It's not efficient but it's silly.

$ echo "THIS IS SILLY" | ./gcat
Size: 14
GGGGGCGGGAGGGTGGGGCGGCCGGACGGTCGGGAGGCAGGAAGGTAGGGTGGCTGG

[editline]30th March 2011[/editline]

Now I just need to check if those GCATs are correct!

[editline]30th March 2011[/editline]

Nope, they're not... Seems like even null input generates something.

I'm probably not reading it correctly.

[editline]30th March 2011[/editline]

$ echo "THIS IS SILLY" | ./gcat
Size: 14
TATTTAATTATGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT

Better... But still not all that good. T is zero.[/QUOTE]
That's pretty cool, what are you using to encode each letter?

[esalaka]

[QUOTE=Chris220;28895069]That's pretty cool, what are you using to encode each letter?[/QUOTE]

I'm pulling the letters from static char * GCAT = "TACG";

Also I just realized why that doesn't work. :3

[editline]30th March 2011[/editline]

$ echo "THIS IS SILLY" | ./gcat
Size: 14
TAAATCTAACTAGTAATTCTACTAGTAATTCTGTAAACTATGTATGTAACAACCTT

Seems to work now :3:

[editline]30th March 2011[/editline]

That is, every four-character sequence is a byte; G = 11b, C = 10b, A = 01b, T = 00b.

[editline]30th March 2011[/editline]

Now I guess I should make a decoder too

[editline]30th March 2011[/editline]

[esa@esa-pc-arch GCAT]$ echo -n 'Hello WAYWO!' | ./gcat 
Size: 12
TCTAAACATGCATGCAGGCATTCTGAAAATTAACAAGAAAGGTAATCT

It can't be efficient 'cause it quadruples the size.

However, saving settings in RNA-encoding would be fucking awesome. Even if the sequences make no sense.

[Chryseus]

[img]http://i.cubeupload.com/0SkoVT.png[/img]

My first serious attempt at using Java AWT/Swing.
[url=http://solidfiles.com/d/50b94/]Download[/url]

[thomasfn]

[QUOTE=esalaka;28895143]I'm pulling the letters from static char * GCAT = "TACG";

Also I just realized why that doesn't work. :3

[editline]30th March 2011[/editline]

$ echo "THIS IS SILLY" | ./gcat
Size: 14
TAAATCTAACTAGTAATTCTACTAGTAATTCTGTAAACTATGTATGTAACAACCTT

Seems to work now :3:

[editline]30th March 2011[/editline]

That is, every four-character sequence is a byte; G = 11b, C = 10b, A = 01b, T = 00b.

[editline]30th March 2011[/editline]

Now I guess I should make a decoder too

[editline]30th March 2011[/editline]

[esa@esa-pc-arch GCAT]$ echo -n 'Hello WAYWO!' | ./gcat 
Size: 12
TCTAAACATGCATGCAGGCATTCTGAAAATTAACAAGAAAGGTAATCT

It can't be efficient 'cause it quadruples the size.

However, saving settings in RNA-encoding would be fucking awesome. Even if the sequences make no sense.[/QUOTE]

All we need now is an effective way of changing human DNA on-the-fly, and then we can use the human body as a hard drive. :v:

[esalaka]

[QUOTE=thomasfn;28895604]All we need now is an effective way of changing human DNA on-the-fly, and then we can use the human body as a hard drive. :v:[/QUOTE]

I could also try compressing data beforehand. That would reduce the space it takes.

[Frugle]

I added my weapon generator I made earlier this year into my game.

[img]http://f.anyhub.net/2m5l[/img]

[esalaka]

Turns out that a binary file filtered through xz -9 -c is only .267433680795772314 (appr. 26.7%) the size of the uncompressed one.

This is good news, I guess. With compression ratios like these you can actually have approximately the same amount of bytes after data->compress->encode!

[ColdFusion]

You would think that with all that money they would be able to hire a webdeveloper.

[url]http://www.starstonesoftware.com/OpenGL/[/url]

[Rohan]

[QUOTE=Darwin226;28894899]An interpreted scripting language.[/QUOTE]
[url=http://code.google.com/p/asmjit/]Or...[/url]

[CarlBooth]

I'm having a brain-fart moment here

I want to have "states" for certain groups of variables so I can quickly set them to appropriate values

e.g.

State 1
X = "orange"
Y = "apple"
Z = "pear"

State 2
X = "blue"
Y = "green"
Z = "purple"

State 3
X = "north"
Y = "south"
Z = "east"

What's this called...

[Shrapnel :3]

State machine? Switch case? Not sure what the question is :P

[Sakarias88]

I wouldn't call it an SM of FSM.
I'm not sure but maybe you mean some sort of enumaration?

[NovembrDobby]

Working on my prolog assignment for uni, we have to make systems that can classify animals and do inheritance stuff and things. There's a ridiculous bug or something in the uni's version of Prolog (but not mine) where it doesn't backtrack properly when trying to satisfy rules, but I just found out I can fix it by adding

nl, fail.

to the end of each rule. Fun.

[img]http://i.imgur.com/WDcb8.png[/img]

Also I'll post some nice updates on something else I've been working on tomorrow, if I'm still awake :buddy:

[Neo Kabuto]

[QUOTE=CarlBooth;28896929]I'm having a brain-fart moment here

I want to have "states" for certain groups of variables so I can quickly set them to appropriate values

e.g.

State 1
X = "orange"
Y = "apple"
Z = "pear"

State 2
X = "blue"
Y = "green"
Z = "purple"

State 3
X = "north"
Y = "south"
Z = "east"

What's this called...[/QUOTE]

Maybe you're thinking of enumerations?

EDIT: Oh, sorry. Didn't see the other guy.

[backwardspy]

[QUOTE=ColdFusion;28896559]You would think that with all that money they would be able to hire a webdeveloper.

[url]http://www.starstonesoftware.com/OpenGL/[/url][/QUOTE]
[h2]Da Code[/h2]

[T3hGamerDK]

A small and rather basic version of wget written in Python. Currently it's way too simple to actually print the process in a pretty way (it just prints each update on a newline)
Have a crack at it if you want [url="http://dl.dropbox.com/u/5579836/Code/get.py"]get.py[/url]

[neos300]

Finally got my git system working so I don't have to manually copy and paste files to push to a git.

Also, is there any way to bring up a tortise git commit/push window via console/batch file so I don't have to right click on the folder every time I want to commit?

[CarlBooth]

Yeah - I did it with enums and a switch in the end, but I'm sure there's a better way.

[ZeekyHBomb]

You can also use an array
[cpp]struct StateVariables
{
public:
enum VariableName
{
x = 0,
y,
z,
lastIndex
};

private:
enum
{
numStates = 3
};

public:
StateVariables():state(0){}

const std::string& operator[](const VariableName index) const{ return variables[state][index]; }

void setState(const int state){ this->state = state; }

private:
static const std::string variables[numStates][lastIndex];
};

const std::string StateVariables::variables[StateVariables::numStates][StateVariables::lastIndex] =
{
{ "orange", "apple", "pear" },
{ "blue", "green", "purple" },
{ "north", "south", "east" }
};[/cpp]

[Jimbomcb]

[url]http://heat.jimbomcb.net[/url]

renders about twice as quick as it did before, still room for improvement though, doesn't appear to be scaling awfully well with a lot of extra samples (6 samples takes 0.49 seconds, 2636 takes 1.55 seconds)

[Shanethe13]

Just submitted my application to the Blackberry App World. Not the best thing I've made, but it only took about two hours, while learning Actionscript and Adobe Air at the same time. If the Apple App store is anything to go by, it should at least meet the minimum quality requirements.

[IMG]http://i.imgur.com/jIOYu.png[/IMG]

[IMG]http://i.imgur.com/2G2mI.png[/IMG]

Free Playbook here I hopefully come?

[Irtimid]

What did you do to be able to use flash files in the package?

[Shanethe13]

[QUOTE=Irtimid;28900559]What did you do to be able to use flash files in the package?[/QUOTE]

RIM actually hasn't released the java-sdk yet for the Playbook, so you need to use Adobe Air to write the applications. I've never made an actual Flash game/animation before, so I don't know whether it is the same idea, but in this case it was just using pure actionscript to manipulate images. You can also use something called Flex, but as I said, I've never used actionscript before, so I don't know what the difference would be there.

[Irtimid]

I didn't know AS was an option... Flex was terrifying so I've been developing mine with javascript.

[Shanethe13]

[QUOTE=Irtimid;28900760]I didn't know AS was an option... Flex was terrifying so I've been developing mine with javascript.[/QUOTE]

Javascript? How are you doing that? I didn't know that was supported.

[Irtimid]

I'm using the "WebWorks" SDK wtih Adobe Air.

[Shanethe13]

[QUOTE=Irtimid;28900836]I'm using the "WebWorks" SDK wtih Adobe Air.[/QUOTE]

Oh cool! Well, good luck, you still have a few hours to go before the deadline. Has your account been approved, and your signing keys sent out though? Since that took nearly a week for me, so I'd make sure that's done before anything.