[quote=everyone]binary shit[/quote]
[img]http://www.facepunch.com/fp/emoot/effort.gif[/img]
So what did I miss, other than a great thread whose OP was snipped?
[editline]9th October 2011[/editline]
In other news, I think Soluto is kinda nice but doesn't really do anything I'd keep it for. Too lazy to uninstall it, though.
But I just noticed an option in its tray icon, "My PC Just Frustrated Me" :v:
Old content but I never posted it here.
So I was on the new computers our school library has. (The sticker on the front said they all have Win7 but of course the district said "fuck that shit" and put WinXP on it, le sigh)
So anyway there I am, fixing up a file for web design, checking online grades, when I notice something on the side of the computer. My immediate thought was "is that what I think it is".
It was. The key for the copy of Win7 (Professional iirc) was on the side of the computer. No censorship either, just there for someone to take.
[QUOTE=lavacano;32694164]Old content but I never posted it here.
So I was on the new computers our school library has. (The sticker on the front said they all have Win7 but of course the district said "fuck that shit" and put WinXP on it, le sigh)
So anyway there I am, fixing up a file for web design, checking online grades, when I notice something on the side of the computer. My immediate thought was "is that what I think it is".
It was. The key for the copy of Win7 (Professional iirc) was on the side of the computer. No censorship either, just there for someone to take.[/QUOTE]
Bring camera, take photos of all of them
[QUOTE=Killowatt;32693489]Why do you know that[/QUOTE]
I browse /co/
I remember back when Vista was new, I looked at some desktop computers in a store and noticed they had replaced Vista with non-genuine XP (what). So I looked at the side and, sure enough, Vista key. Then I brought over a friend and we got 3 free vista keys :v: Then I proceeded to install Vista on my POS 2.6GHz Celeron single core with 1GB RAM. :allears:
[QUOTE=lavacano;32694164]Old content but I never posted it here.
So I was on the new computers our school library has. (The sticker on the front said they all have Win7 but of course the district said "fuck that shit" and put WinXP on it, le sigh)
So anyway there I am, fixing up a file for web design, checking online grades, when I notice something on the side of the computer. My immediate thought was "is that what I think it is".
It was. The key for the copy of Win7 (Professional iirc) was on the side of the computer. No censorship either, just there for someone to take.[/QUOTE]
Gee, I could sure do with another copy of win 7. I've got an old laptop hanging around here that's stuck on vista...
Bit of an oddity from my LAN party a while ago. I had this really short cat-5 cable, about 60CM long. Perfect for my pc to my hub (I used a dead modem as a second hub, the modem part was fucked every other bit worked perfectly) which was behind my PC. This little cable was a bit old and sat in my school pencil case for a few months (Don't ask, I don't remember why) and got a bit fucked up.
I learned that it did get a bit fucked up, more than I thought. Every time I tried to access the network my PC Bluescreened. Oh boy, that was fun.
[QUOTE=ButtsexV3;32689233]motherless.com
what are you doing that site is gross[/QUOTE]
it's part of the censorship checks
just like partypoker and stormfront and the others
what the fuck is stormfront even never heard of it
better check it out now
edit:
oh, nice, some white pride forum
[QUOTE=nikomo;32680033]Checking why wireless isn't doing quite as well as I hoped it would.
"wifi analyzer and vaginafrog"[/QUOTE]
Is there software like that for windows or iPhone?
[editline]9th October 2011[/editline]
[QUOTE=areolop;32693692]B1NARY; decoded
[/QUOTE]
A small proportion of dark matter may be baryonic dark matter: astronomical bodies, such as massive compact halo objects, that are composed of ordinary matter but which emit little or no electromagnetic radiation. The vast majority of dark matter in the universe is believed to be nonbaryonic, and thus not formed out of atoms. It is also believed that it does not interact with ordinary matter via electromagnetic forces; in particular, dark matter particles do not carry any electric charge. The nonbaryonic dark matter includes neutrinos, and possibly hypothetical entities such as axions, or supersymmetric particles. Unlike baryonic dark matter, nonbaryonic dark matter does not contribute to the formation of the elements in the early universe ("Big Bang nucleosynthesis") and so its presence is revealed only via its gravitational attraction. In addition, if the particles of which it is composed are supersymmetric, they can undergo annihilation interactions with themselves resulting in observable by-products such as photons and neutrinos ("indirect detection").[6]
Nonbaryonic dark matter is classified in terms of the mass of the particle(s) that is assumed to make it up, and/or the typical velocity dispersion of those particles (since more massive particles move more slowly). There are three prominent hypotheses on nonbaryonic dark matter, called Hot Dark Matter (HDM), Warm Dark Matter (WDM), and Cold Dark Matter (CDM); some combination of these is also possible. The most widely discussed models for nonbaryonic dark matter are based on the Cold Dark Matter hypothesis, and the corresponding particle is most commonly assumed to be a neutralino. Hot dark matter might consist of (massive) neutrinos. Cold dark matter would lead to a "bottom-up" formation of structure in the universe while hot dark matter would result in a "top-down" formation scenario.[7]
One possibility is that cold dark matter could consist of primordial black holes in the range of 1014 kg to 1023 kg.[8] Being within the range of an asteroid's mass, they would be small enough to pass through objects like stars, with minimal impact on the star itself. These black holes may have formed shortly after the big bang when the energy density was great enough to form black holes directly from density variations, instead of from star collapse. In vast numbers they could account for the missing mass necessary to explain star motions in galaxies and gravitational lensing effects.
[QUOTE=LiquiD;32695180]Is there software like that for windows or iPhone?
[/QUOTE]
You can get Wifi Analyzer for iPhone
I found out a couple things while attempting an OC. I was underclocked before I started and resetting the CMOS doesn't really work on the nvidia nforce2 mobo (afaik) instead, it has a "safe mode" jumper you have to flip which sets everything to low settings, you go and reset to default, flip the jumper back to normal and work from there. I should really print out a copy of my mobo's manual one of these days so I'm not frantically doing research on my DSi wondering why something isn't working.
I did get a boost of about 750MHz though, so not all was lost.
[QUOTE=lavacano;32694164]Old content but I never posted it here.
So I was on the new computers our school library has. (The sticker on the front said they all have Win7 but of course the district said "fuck that shit" and put WinXP on it, le sigh)
So anyway there I am, fixing up a file for web design, checking online grades, when I notice something on the side of the computer. My immediate thought was "is that what I think it is".
It was. The key for the copy of Win7 (Professional iirc) was on the side of the computer. No censorship either, just there for someone to take.[/QUOTE]
They put windows XP back on it because if they wanted to use windows 7, they would have to put it on every single machine in the entire domain (Possibly thousands of licences/lots of dollars)
otherwise you get silly shit happening up at the administration level while trying to manage windows 7 and windows XP computers.
Also those stickers are probably OEM, and you cannot use the keys for anything really. they will be
XXXX-XXXX-OEM-XXXX-XXXX or something similar and you cannot type that in when you install windows
have the rules on that changed or something because i've used the w7 sticker from 2 of my laptops multiple times and it's just sort of worked
Damnit, I'm stuck watching demoscene videos again :saddowns:
[hd]http://www.youtube.com/watch?v=z64ILYTIAC4&feature=related[/hd]
I was playing the sims when I realised everything was in comic sans
[img]http://filesmelt.com/dl/Sims_2011-10-09_08-03-49-50.png[/img]
COMIC SANNNSSSSSSSSS
[QUOTE=David Tennant;32691615][img]http://ecx.images-amazon.com/images/I/41CPVOMhJYL._SL500_AA300_.jpg[/img]
Buying a good racing wheel is the best thing I've ever done for my computer other than getting dual screens.[/QUOTE]
Racing wheels is where it's at. If you get the chance, Try playing something like Need For Speed: Shift with it. Ridiculously fun. Also hard when your car starts nearing the 250 km/h limit
6 min and ahead
[media]http://www.youtube.com/watch?v=2xs0oHgYOa4&hd=1&t=6m[/media]
[QUOTE=BreenIsALie;32696502]Racing wheels is where it's at. If you get the chance, Try playing something like Need For Speed: Shift with it. Ridiculously fun. Also hard when your car starts nearing the 250 km/h limit
6 min and ahead
[media]http://www.youtube.com/watch?v=2xs0oHgYOa4&hd=1&t=6m[/media][/QUOTE]
off topic but is the first nfs: shift any less terrible than shift 2?
[QUOTE=zerosix;32696724]off topic but is the first nfs: shift any less terrible than shift 2?[/QUOTE]
Nope.
[QUOTE=zerosix;32696724]off topic but is the first nfs: shift any less terrible than shift 2?[/QUOTE]
Never tried Shift 2 but i liked Shift 1. Great game for using steering wheel imo
[QUOTE=BreenIsALie;32696502]Racing wheels is where it's at. If you get the chance, Try playing something like Need For Speed: Shift with it. Ridiculously fun. Also hard when your car starts nearing the 250 km/h limit
6 min and ahead
[media]http://www.youtube.com/watch?v=2xs0oHgYOa4&hd=1&t=6m[/media][/QUOTE]
that looks retarded, they accellerate like they have a rocket attached
Oh wow. My old YouTube channel with 1 video and 140 subs just got invited to make money with ADs. Well, screw the new channel I guess :v:
I was about to come in here and complain about the price of hardware in the UK compared to prices in the US, but I did some checking beforehand and I found that I'm wrong (in this case at least)
I was wondering whether to buy my new processor, motherboard and RAM in the US when I go over - in 65 days 14 hours and 37 minutes - or here in the UK when I get back in January. So I picked out a P8Z68-v Asus Board, the i5 2500k and a 4gb kit of corsair RAM on [url]www.scan.co.uk[/url] and the total came up to £272.16 which is $423.263232. So I checked it out on Newegg and found that exactly the same deal would cost me $434.97 which is £279.6875.
I suppose I'll have to check over it again when I'm actually in the states, and work out combo deals and stuff but I found it funny how for once something is cheaper over here.
[editline]9th October 2011[/editline]
sidenote: can I power a 2500k and a hd5770 on a 500w (OCZ modular) PSU?
[QUOTE=Shadaez;32697172]that looks retarded, they accellerate like they have a rocket attached[/QUOTE]
It's not amazingly realistic, but that's what cars like the veyron do.
[QUOTE=BreenIsALie;32696799]Never tried Shift 2 but i liked Shift 1. Great game for using steering wheel imo[/QUOTE]
I've been going through my whole collection and it includes shift, shift is fun but definitely more relaxing (except when driving the insane cars) than most of the others, I've found DiRT 1 and 3 to be the most fun as the force feedback is surreal and if you set the wheel to 900° your arms will start to ache on the 3rd race, I did a tonne of research before I laid down £100 for the wheel.
As a reaction to the previous page
[code]CTTAAACATAGATTCTACGAGGCAAAGATTCTGACAAAGAACGAGTGATTCTGTCAATCA
CGCAGACTTAGATTCTTACAAACAGTCAGGCATACAAACATTCTTAGATCCAACCAGTGACGCTC
CTTCCTTTAAATCCAAACATTCTCACAACCACTGAGTGATAGATTCTGGCACGCAAACATTCTTAG
AGGCATTCTTACAGGCATTCTGTGAGGCATTCTGACAAACATAGAGTGATTCTTAGATCCAAACA
TTCTTGCAATCACTGAGACAAACAGTGATAGATTCTGTCAGGCAGGCAGCCAACCAAACATTCT
TAGATCCAAACACTGAAACATTCTACCAGTGACGCTCCTTCCTTCTAAAACATTGATGCAACGAT
TCTGAGAACCATAGATCCATTCTCTCTTTAAATCACGCAGTCAATCAGCCAAACAGTGACTCTTT
CTACCACACATTCTACGAGGCAAAGATTCTTACAAACAGTCAGGCATACAAACATACACCTT[/code]
(Ignore line breaks, only GCAT is data)
Seriously stop.
Yes, please.
[QUOTE=esalaka;32698144]As a reaction to the previous page
[code]CTTAAACATAGATTCTACGAGGCAAAGATTCTGACAAAGAACGAGTGATTCTGTCAATCA
CGCAGACTTAGATTCTTACAAACAGTCAGGCATACAAACATTCTTAGATCCAACCAGTGACGCTC
CTTCCTTTAAATCCAAACATTCTCACAACCACTGAGTGATAGATTCTGGCACGCAAACATTCTTAG
AGGCATTCTTACAGGCATTCTGTGAGGCATTCTGACAAACATAGAGTGATTCTTAGATCCAAACA
TTCTTGCAATCACTGAGACAAACAGTGATAGATTCTGTCAGGCAGGCAGCCAACCAAACATTCT
TAGATCCAAACACTGAAACATTCTACCAGTGACGCTCCTTCCTTCTAAAACATTGATGCAACGAT
TCTGAGAACCATAGATCCATTCTCTCTTTAAATCACGCAGTCAATCAGCCAAACAGTGACTCTTT
CTACCACACATTCTACGAGGCAAAGATTCTTACAAACAGTCAGGCATACAAACATACACCTT[/code]
(Ignore line breaks, only GCAT is data)[/QUOTE]
I'm rusty on reading DNA but it looks like it says "BAN ME" to me.
Sorry, you need to Log In to post a reply to this thread.